WWW.CHFPN.PL

Mitologia nadrzędnej roli DNA

MITOLOGIA NADRZĘDNEJ ROLI DNA
O. Prof. Piotr Lenartowicz SJ
Referat przedstawiony podczas konferencji ChFPN "Bryza"
Kościelisko 2010


 

„Deficyt informacyjny” DNA oznacza fakt, że w DNA brakuje ogromnych ilości informacji a organizm mimo to żyje!

 Ilustracją zagadnienia deficytu informacyjnego DNA będzie analiza procesu produkowania tRNATyr u drożdży. Co to jest tyrozyna? Tyrozyna jest jednym z 20 aminokwasów, które w organizmie żywym odgrywają rolę Klocków Lego.

 Jak każdy aminokwas, tyrozyna posiada na jednym końcu grupę aminową (zasadową, elektrododatnią), a obok niej grupę karboksylową (kwaśną, elektroujemną,). Dzięki tym dwu grupom atomów każdy aminokwas może być połączony z każdym takim samym lub innym aminokwasem. Na drugim końcu tego aminokwasu znajduje się tzw. „reszta”, czyli taka grupa atomów, która w każdym z 20-tu podstawowych aminokwasów jest inna, analogicznie, jak w klockach Lego, które mają rozmaite kształty i właściwości.

Tyrozyna jest więc jedną z wielu różnorodnych cegiełek, fragmentów chemicznych, z których żywy organizm buduje swoje nanomaszyny (enzymy), oraz swoje różnorodne struktury podporowe, ochronne … itp.

Jak powstają aminokwasy?

 W organizmach żywych aminokwasy powstają inaczej niż w materii mineralnej. W materii mineralnej, pod wpływem silnych wyładowań energii elektrycznej, w roztworze rozmaitych, mineralnych związków węgla, mogą powstawać pojedyncze cząsteczki takiego lub innego aminokwasu.

 Tego typu procesy radykalnie różnią się od procesów biosyntezy aminokwasów. Jak wyrazić tę różnicę? Otóż w skale wapiennej może powstać „ściana” a w niej „okno”. W skale wapiennej mogą powstać „drzwi” lub „półki”. Ale ściana domu budowanego przez człowieka, okna i drzwi w tym domu powstają zupełnie inaczej, niż „półki”, „ściany”, „okna” w skałach jurajskich.

 Aminokwasy są budowane przez bakterie, grzyby, komórki ssaków i człowieka tak, jak człowiek buduje dom, a nie tak, jak powstają skały wapienne i ich kształty. Organizm żywy chwyta pojedyncze atomy (węgla, wodoru, tlenu, azotu, niektórych metali) i taki atom zostaje natychmiast umieszczony w precyzyjnie określonym miejscu, w określonej grupie chemicznej, a nie „pęta się” luzem w cytoplazmie. Dlatego produkcja najprostszych nawet aminokwasów wymaga z reguły kilkudziesięciu precyzyjnych przekształceń chemicznych, dokonywanych przez dziesiątki molekularnych nanomaszyn.

 Przykładem tej absolutnej precyzji w biosyntezie aminokwasów jest fakt, że organizm kontroluje nie tylko budowę chemiczną, ale też prawo, lub lewoskrętność cząsteczek aminokwasów – zależnie od tego jaka, prawo, czy lewoskrętna cząsteczka jest potrzebna. To jest tak, jakby ktoś opiekujący się jednorękimi inwalidami, kontrolował kiedy zrobić rękawiczkę na lewą rękę, a kiedy na prawą.

Organizm w wielkich ilościach syntetyzuje cząsteczki opisywanych wyżej aminokwasów, a następnie buduje z nich rozmaitego typu nanomaszyny. Przyjmuje się, że najprostsza komórka bakteryjna jest w stanie wybudować przynajmniej 3 tysiące różnorodnych nanomaszyn. Każda z nich składa się z 200, 300 … a nawet wielu tysięcy aminokwasów.

 Przykładowo, ATPaza protonowa u grzyba Neurospora crassa jest złożona z 920 aminokwasów (Hager et al. 1986).

 Proces budowania nanomaszyny jest bardzo skomplikowany.

  • Najpierw, organizm żywy łączy pojedyncze aminokwasy w stosunkowo długie nici, które zwykle zawierają od kilkudziesięciu do kilkuset aminokwasów, ułożonych w ściśle określonej kolejności.
  •  Potem, te długie nici (tzw. polipeptydy) są zwijane, skręcane w kłębuszki w których pozycja poszczególnych atomów jest ściśle określona.

 Jednak aminokwasy nie „fruwają” po wnętrzu komórki luzem, ale są transportowane do rybosomów przez cząsteczki zwane tRNA. Rola tRNA jest podobna do roli lawety która przewozi rakietę. „Rakietą” w wypadku tRNA jest konkretny aminokwas. Każdy z 20 aminokwasów ma swój typ transportera.

 Skąd się biorą cząsteczki transportującego RNA?

 Surowa matryca takiej cząsteczki jest zapisana w określonym segmencie cząsteczki DNA. Tę surową matrycę transportera do przenoszenia aminokwasu tyrozyny nazywa się genem tRNATyr.

Oto gen dla tRNATyr

CAATAGTCAATTAACTCAGAGCCATCGGTTC
AACCAAATCCGCGTTCTGACATTAAATGGTG
ATGCTTTATAACTCTATCCCTCAAGCTGAGC
GGGGGCCCTCTAAT

 Składa się on ze 108 nukleotydów. Nie są one jednakowe, ale występują w czterech różnych formach: ACGT   (A – adenina; C – cytozyna; G – guanina; T – tymina)

Organizm wykonuje rodzaj kopii tego genu (czyli tej określonej sekwencji nukleotydów). Oto owa kopia:

GUUAUCAGUUAAUUGAGUCUCGGUAGCCAAG
UUGGUUUAGGCGCAAGACUGUAAUUUACCAC
UACGAAAUAUUGAGAUAGGGAGUUCGACUCG
CCCCCGGGAGAUUA

 Ta kopia jest pewną modyfikacją genu. Cukier dezoksyryboza został w każdym elemencie tej kopii zamieniony na cukier rybozę. Natomiast tymina (T) została tu podstawiona przez uracyl (U). Jest to pierwszy prekursor dla tRNA tyrozyny.

Większość współczesnych biologów wierzy, że na nici DNA w chromosomach zapisana jest Kompletna Informacja, która steruje procesami budowy wszystkich struktur żywego organizmu.

 Czy to jest Wiedza, czy to jest Wiara?

W tym referacie postaram się ukazać, że w DNA rzeczywiście jest zawarta ogromna informacja, bez której organizm nie może funkcjonować – ale postaram się też pokazać, że nie jest to ani informacja kompletna, ani informacja czynna.

W DNA jest zawarta informacja zaszyfrowana, niekompletna i całkowicie bierna. DNA jest tylko rodzajem „ściągawki”. „Ściąga” jest zaszyfrowanym skrótem. Nie ma sensu przepisywać całego podręcznika na rękawie „Ściąga” jest napisana „chaotycznie” – rozmieszczenie zaszyfrowanych informacji zna dobrze autor.

 Co jest autorem tej „ściągawki” i co jest jej użytkownikiem? „Istota Życia” („dusza”) danego organizmu [ mrówki, motyla, wiewiórki, człowieka, bobra ] umie z tej ściągawki korzystać i uzupełniać brakującą informację z jakiegoś nieznanego, tajemniczego źródła. Zobaczymy, że tej „uzupełniającej” informacji potrzeba znacznie więcej, grubo więcej, niż to, co jest zapisane w szyfrach molekularnych DNA.

 Zupełnie podobnie, dokumentacja techniczna, którą na kalce technicznej otrzymuje majster na budowie, jest bierną „ściągawką”. Korzystanie z tej „ściągawki” wymaga wiedzy „majstra” czyli Mistrza. „Ściągawka” jest pomocą, ale pomocą bierną. Dokumentacja techniczna ani sama materiałów nie zdobędzie, ani sama domu nie wybuduje.

 Chcę pokazać, że w DNA brakuje informacji koniecznej do budowy skomplikowanych cząsteczek chemicznych. „Zmuszę” Państwa do zajrzenia w zakamarki struktur prawie milion razy mniejszych niż milimetr sześcienny Chciałbym, aby Państwo uwierzyli, że zdrowy rozsądek działa nie tylko w centymetrach i metrach, ale równie dobrze można z niego korzystać w skali mikronów i Angstromów.

 Oto uproszczony schemat struktury wczesnego transkryptu tRNA. Wczesny transkrypt powinien być ukazany jako jedna ciągła linia. Pewne obszary tej linii zostaną usunięte, inne „skleją się” ze sobą, a pewne elementy zostaną dodane. Żółty odcinek ma rolę ochronną dla „antykodonu” – podobnie jak plastikowa pochewka służy jako osłona igły w strzykawce do jednorazowego użytku.

Transkrypt ulega wielu modyfikacjom zanim stanie się pełnowartościowym transporterem aminokwasu tyrozyny. Zielonkawy odcinek u góry zostanie usunięty. Podobnie usunięty zostanie odcinek żółty u dołu.

Precyzja tych modyfikacji jest ogromna. Jednak to chyba oczywiste, że ani tej informacji, ani tej modyfikacji nie można przypisać podwójnej helisie DNA. Skąd ta informacja pochodzi ? Tego nie wiadomo. Na miejsce niebieskiego UU zostanie wstawiony odcinek CCA – przyczep aminokwasu. Strzałki oznaczają modyfikacje poszczególnych nukleotydów.

Surowy, nie zmodyfikowany transkrypt składa się ze 108 cząsteczek („koralików”). W surowym transkrypcie występują one w czterech formach: A C G U (A – adenina; C – cytozyna; G – guanina; U – uracyl)

 Gdyby tych 108 „koralików” rozsypać, to ile różnorodnych „naszyjników” dałoby się z nich ułożyć?

 To da się obliczyć – ich liczba wynosi

 mn

gdzie m to liczba różnych „koralików” (czyli ACGU) = 4, a n to liczba wszystkich „koralików” – czyli 108. Zatem, mając do dyspozycji 4 rodzaje „koralików” możemy otrzymać

 4108 = ok. 1064

niepowtarzalnych „naszyjników”, złożonych ze 108 „koralików”. Oznacza to, że dzięki genowi DNA organizm od razu buduje taki łańcuszek, który już z grubsza posiada strukturę tRNA dla tyrozyny. Gen dokonuje jakby wstępnej selekcji rzędu 1:1064 To właśnie jest owa wspaniała „informacja” zawarta w genie.

 Co się dalej dzieje z prekursorem tRNA?

  •  Niektóre jego części są precyzyjnie wycinane.
  •  Kilka elementów jest dodanych.
  •  Wiele z „koralików” ulega modyfikacjom.

 Tak wygląda gotowy tRNATyr – a ściślej jego struktura I-rzędowa.

 Jest to „naszyjnik” krótszy od genu, albowiem liczy tylko 79 „koralików”. Ponadto, te „koraliki” występują nie w 4, ale w 11 formach.

Teraz możemy powtórzyć to samo pytanie, które zadaliśmy poprzednio. Ile różnorodnych „naszyjników” dałoby się ułożyć z tych 79 „koralików” o 11 różnych formach? Liczba takich teoretycznie możliwych „naszyjników” wynosi:

ok. 1081

To oznacza, że wprawdzie gen DNA „dokonał” selekcji rzędu 1064, ale taka precyzja jest zdecydowanie nie wystarczająca. Miarą tej niewystarczalności, czyli miarę deficytu informacji może być następująca kalkulacja:

 Gen DNA (dla tRNATyr) dostarczył informacji rzędu 1064. Okazało się, że do wyprodukowania jednego tylko typu tRNA (dla tyrozyny) potrzebna była informacja rzędu powyżej 1081. Czyli selektywność, wynikająca ze struktury genu DNA stanowi tylko cząstkę wymaganej selektywności.

 Jak duża jest ta „cząstka”?

 Wynosi ona 1081 podzielone przez 1064.

 Gdy wykonamy to dzielnie (więc odejmowanie wykładników), to otrzymamy wynik

 1017

To tak, jakbyśmy od 100.000.000.000.000.000 odjęli 1 - różnica widoczna byłaby dopiero na 17-tym miejscu! 

 Selektywność genu DNA jest więc o ok. 17 rzędów wielkości mniejsza niż selektywność rzeczywistego procesu produkcji tRNATyr. Reszta tej selektywności pochodzi z nieznanego źródła.

 W jaki sposób można by zilustrować ową różnicę między informacją zawartą w genie DNA, a informacją zawartą w tRNATyr?

Użyjmy przykładu z formą (tortownicą) do pieczenia biszkoptu i gotowym tortem. Tortownica determinuje tylko kształt i wielkość samego biszkoptu. Natomiast liczba warstw tortu, masa oddzielająca przekrojone krążki biszkoptu, polewa na torcie, ozdoby na wierzchu, itp., to informacja, której nie ma w tortownicy. Ta informacja zawarta jest w „głowie” cukiernika lub Pani Domu.

Inny przykład - z „formą” wytłaczającą karoserię i gotowym samochodem. „Forma” determinuje tylko kształt i wielkość karoserii. Cała reszta – od koloru lakieru począwszy na elektronice i silniku skończywszy jest w „głowie” inżynierów i techników. Na rycinie poniżej, 4 symbole nukleotydów zostały zamienione na 4 symbole kart do gry.

Te cztery symbole nie wystarczają by opisać złożoność funkcjonalnej cząsteczki tRNA. Musi ich być aż 11.

 A przecież rozważaliśmy produkcję tylko jednej z tysięcy cząsteczek produkowanych przez komórkę w każdej sekundzie. W ciągu jednej sekundy komórka bakteryjna produkuje około 17 tysięcy nowych tRNA (ok. 40 różnych form – dla różnych aminokwasów).

 Dlaczego aż 40 form tRNA, skoro jest tylko 20 aminokwasów? Otóż w genach występuje 61 kodonów dla tych 20 aminokwasów. Niektóre aminokwasy są przenoszone kilkoma, odmiennie skonstruowanymi tRNA. Stąd liczba różnych form tRNA wynosi ponad 40.

 
Copyright (c) 2000 - 2018 Ruch Nowego Życia
All Rights Reserved
[ created by hornet.com.pl ]
WEB interface